|
BaNG Nematode and Neglected Genomics |
 |
|
| The Blaxter Lab at the Institute of Evolutionary Biology, University of Edinburgh | ||
MOTU_define.pl
Frequently asked questions (and answers)
What is a MOTU? Input files for MOTU_define.pl The base difference cutoff Why do different runs give different clustering? How do I parse the output? What has changed recently?
Input files for MOTU_define.pl
The input format for MOTU_define.pl is fasta formatted DNA sequence. Fasta format looks like:All the sequences must be in separate fasta files. The programme copes with non-A/G/T/C base calls (all are coded "N").>sequence name
AGCGGTGGCGTGGCGGTGGCGGTGGCCGGTG
AGCGGTGGCGTGGCGGTGGCGGTGGCCGGTG
AGCGGTGGCGTGGCGGTGGCGGTGGCCGGTGThe base difference cutoff
MOTU_define.pl uses a simple difference cutoff to place sequences into MOTU. The cutoff is set by the user, and can be varied in different runs to explore the effects of different cutoff values on clustering. MOTU_define.pl does not explicitly use a tree to define MOTU, though of course the use of BLAST implies that some phylogenetic relationship is expected.Why do different runs give different clustering?
MOTU_define,pl uses single-linkage clustering: if a sequence is close enough (given the cutoff) to another, they are clustered. In some cases thie order of analysis of sequences can change clustering. Consider three sequences, A, B and C. A differs from B by 2 changes and B from C by 2 changes. C differs from A by 4 changes. If we use a cutoff of 2>2 differences, the order in which we add sequences will change clustering: A then C then B and C then A then B will yield two clusters as A and C will not be linked. Any other clustering will yield one. The pattern of distribution of different clustering can yield interesting information concerning "clouds" of closely related specimens that do not robustly form distinct MOTU under specific parameters.How do I parse the output
We have not implemented comparison routines in the software, but the output is easily analysed in, for example, Excel-type spreadsheets, or with simple perl scripts. We will be placing some of these perl scripts on this site soon.
...other interesting things... Blaxter Lab Publications 2006 
Operon Evolution in Nematodes Operons are a common mode of gene organisation in Caenorhabditis elegans. We have traced the origin of operonic gene organisation, and of trans-splicing in a wide range of nematodes. Guiliano DB, Blaxter ML (2006) Operon conservation and the evolution of trans-splicing in the phylum Nematoda. PLoS Genet 2(11): e198. doi:10.1371/journal.pgen.0020198 . |
the content of these pages is copyright Mark Blaxter and colleagues. Contact the webmaster if there are problems.